Journal: The Journal of Biological Chemistry

Article Title: The transmembrane adapter SCIMP recruits tyrosine kinase Syk to phosphorylate Toll-like receptors to mediate selective inflammatory outputs

doi: 10.1016/j.jbc.2022.101857

Figure Lengend Snippet: Syk binds to specific tyrosine residues of SCIMP via its dual SH2 domains. A , schematic diagram of Syk domains and its truncation constructs representing the two tandem SH2 domains with or without linker regions. B , GST-Syk-N-SH2 and Syk-C-SH2 proteins were used to pull down SCIMP from LPS-induced primary BMMs and immunoblotted with SCIMP antibody. C , GST-Syk-N-SH2 and Syk-C-SH2 proteins were used to pull down V5-SCIMP in SCIMP-deficient RAW264.7 cell lines reconstituted with wild type WT, Y58F, Y96F, or Y120F V5-SCIMP. D , coimmunoprecipitation of V5-SCIMP WT and Y58F, Y96F, or Y120F V5-SCIMP from RAW264.7 cell lysates with a V5 antibody, followed by immunoblotting for Syk. Panels B–D are representative of three independent experiments. BMMs, bone marrow–derived macrophages; LPS, lipopolysaccharides; SH2, Src homology domain 2; Syk, Spleen tyrosine kinase.

Article Snippet: Codon-optimized mouse TLR4-TIR (residues 670-835) gene was purchased from Genscript USA and was also subcloned in to the pGEX6p-1 vector. pGEX plasmids for GST-tagged Syk-N-SH2 (residues 6-114, #46520), Syk-C-SH2 (residues 148-264, #46519), and Syk-NC-SH2 (residues 6-264, #46521) domains were all purchased from Addgene.

Techniques: Construct, Western Blot, Derivative Assay

Journal: The Journal of Biological Chemistry

Article Title: The transmembrane adapter SCIMP recruits tyrosine kinase Syk to phosphorylate Toll-like receptors to mediate selective inflammatory outputs

doi: 10.1016/j.jbc.2022.101857

Figure Lengend Snippet: Model of Syk recruitment by SCIMP to TLRs. The transmembrane adapter SCIMP constitutively binds Lyn via a PRD-SH3 interaction. Upon ligand activation of TLR4, activated Lyn kinase phosphorylates SCIMP at three tyrosine sites. The Y96 and Y120 residues then function as two docking sites for the tandem SH2 domains of Syk, which triggers a conformational change of Syk to expose its kinase domain for amplifying SCIMP and TLR4 phosphorylation and enhancing their interaction. SCIMP-scaffolded Syk helps to propagate TLR4 signal transduction to drive proinflammatory cytokine secretion. Syk, Spleen tyrosine kinase; TLRs, Toll-like receptors; SH2, Src homology 2.

Article Snippet: Codon-optimized mouse TLR4-TIR (residues 670-835) gene was purchased from Genscript USA and was also subcloned in to the pGEX6p-1 vector. pGEX plasmids for GST-tagged Syk-N-SH2 (residues 6-114, #46520), Syk-C-SH2 (residues 148-264, #46519), and Syk-NC-SH2 (residues 6-264, #46521) domains were all purchased from Addgene.

Techniques: Activation Assay, Transduction

Journal: bioRxiv

Article Title: The pathogenic T42A mutation in SHP2 rewires interaction specificity and enhances signaling

doi: 10.1101/2023.07.10.548257

Figure Lengend Snippet: ( A ) Domain architecture diagram of SHP2. SHP2 consists of two SH2 domains (yellow and pink) and a phosphatase domain (green). Relevant mutations and the catalytic cysteine (C459) are indicated. ( B ) SHP2 is kept in its auto-inhibited state by interactions between the N-SH2 and PTP domain (PDB: 4DGP). In its active state, the N-SH2 domain is pulled away, and the catalytic cysteine is accessible. Although the structure of SHP2 E76K (PDB: 6CRF) is used to represent the active state, multiple active states likely exist. ( C ) SHP2 is activated by upstream stimuli. The SH2 domains bind to tyrosinephosphorylated upstream proteins, such as transmembrane receptors, inducing a conformational change that activates SHP2. ( D ) Disease-associated mutations cluster largely, but not exclusively, on the interdomain interface between the N-SH2 and the PTP domain (PDB: 4DGP). Highlighted unlabeled mutation sites include: N58, G60, Y62, E69, F71, A72, E76, Q79, D106, E110, Q256, G268, Y279, I282, F285, N308, I309, T411, A461, G464, T468, R498, R501, M504, Q510. ( E ) Mutations in or near the N-SH2 binding pocket (PDB: 6ROY). T42 is engaging the phosphotyrosine of the phosphopeptide ligand, whereas L43 is facing into the SH2 domain core. T52 is near the residues surrounding the phosphotyrosine. ( F ) Mutations in or near the C-SH2 binding pocket (PDB: 6R5G). R138 is engaged with the phosphotyrosine of the phosphopeptide ligand, whereas E139 is facing away from the binding pocket.

Article Snippet: The SHP2 full-length, wild-type gene used as the template for all SHP2 constructs in this study was cloned from the pGEX-4TI SHP2 WT plasmid, which was a generous gift from Ben Neel (Addgene plasmid #8322).

Techniques: Mutagenesis, Binding Assay, Phospho-proteomics

Journal: bioRxiv

Article Title: The pathogenic T42A mutation in SHP2 rewires interaction specificity and enhances signaling

doi: 10.1101/2023.07.10.548257

Figure Lengend Snippet: ( A ) Measured binding affinities of N-SH2 WT against peptides derived from various known SHP2 interactors. ( B ) Fold-change in K D for N-SH2 T42A compared to N-SH2 WT , for each of the peptides shown in panel (A). ( C ) Same as (B), but for N-SH2 L43F . ( D ) Same as (B), but for N-SH2 T52S . Source data can be found in Table S2.

Article Snippet: The SHP2 full-length, wild-type gene used as the template for all SHP2 constructs in this study was cloned from the pGEX-4TI SHP2 WT plasmid, which was a generous gift from Ben Neel (Addgene plasmid #8322).

Techniques: Binding Assay, Derivative Assay

Journal: bioRxiv

Article Title: The pathogenic T42A mutation in SHP2 rewires interaction specificity and enhances signaling

doi: 10.1101/2023.07.10.548257

Figure Lengend Snippet: ( A ) Hydrogen bonding of Thr 42 in SHP2 N-SH2 WT to the phosphoryl group of phosphopeptide ligands, as seen in several crystal structures (PDB codes: 6ROY, 1AYA, 1AYB, 3TL0, 5DF6, 5X94, and 5X7B). ( B ) Structure of N-SH2 WT bound to the PD-1 pTyr 223 (ITIM) peptide at the end of a 1 μs MD simulation, highlighting a hydrogen bond network and other key interactions around the phosphotyrosine residue. ( C ) Structure of N-SH2 T42A bound to the PD-1 pTyr 223 (ITIM) peptide at the end of a 1 μs MD simulation, highlighting a distinct hydrogen bond network around the phosphotyrosine residues, relative to that seen for N-SH2 WT . ( D ) Overlay of the states shown in panels B and C, highlighting a change in position for the phosphotyrosine residue and peptide main chain upon T42A mutation. The N-SH2 WT state is in yellow with a dark-gray ligand. The N-SH2 T42A state is in light gray, with a light gray ligand. ( E ) Distribution of distances between the Lys 55 Nζ atom and the phosphotyrosine phosphorus atοm in simulations of the PD-1 pTyr 223 peptide bound to N-SH2 WT (black) or N-SH2 T42A (red). ( F ) Distribution of distances between the Lys 55 Nζ atom and the +2 Glu Cδ atom in simulations of the PD-1 pTyr 223 peptide bound to N-SH2 WT (black) or N-SH2 T42A (red). ( G ) An ion pair between Lys 55 and the +2 Glu residue (Glu 225) in the PD-1 pTyr 223 (ITIM) peptide, frequently observed in N-SH2 T42A simulations. ( H ) Effects of the T42A mutation in the context of the K55R mutation. The enhancement in binding affinity by the T42A mutation is attenuated by the K55R mutation for some peptides (CagA-D, PD-1 pTyr 223, and MILR1 pTyr 338) but not others (IRS1 pTyr 1179 and Imhof-9).

Article Snippet: The SHP2 full-length, wild-type gene used as the template for all SHP2 constructs in this study was cloned from the pGEX-4TI SHP2 WT plasmid, which was a generous gift from Ben Neel (Addgene plasmid #8322).

Techniques: Phospho-proteomics, Residue, Mutagenesis, Binding Assay

Journal: bioRxiv

Article Title: The pathogenic T42A mutation in SHP2 rewires interaction specificity and enhances signaling

doi: 10.1101/2023.07.10.548257

Figure Lengend Snippet: ( A ) SHP2 activation is measured by incubation with phosphopeptide ligands, followed by monitoring dephosphorylation of the small-molecule substrate DiFMUP to generate fluorescent DiFMU. ( B ) Representative activation curves for SHP2 WT , highlighting peptide-dependent changes in EC 50 and amplitude. ( C ) Correlation between the EC 50 of SHP2 WT activation by phosphopeptides and the K D of those phosphopeptides for the N-SH2 WT domain. ( D ) Correlation between activation EC 50 values for SHP2 WT and SHP2 R 138 Q , which has weakened C-SH2 binding capacity. ( E ) Comparison of SHP2 WT and SHP2 T42A activation curves for the PD-1 pTyr 248 peptide, highlighting a significant impact on both EC 50 and amplitude. ( F ) Comparison of SHP2 WT and SHP2 T42A activation curves for the Imhof-9 peptide, highlighting a minor change in EC 50 and amplitude. ( G ) Bubble plot juxtaposing the EC 50 values for activation of SHP2 WT and SHP2 T42A by nine peptides, alongside the fold-change in K D for binding of those peptides to N-SH2 WT vs N-SH2 T42A . The dotted line indicates where EC 50 values would be equivalent for SHP2 WT and SHP2 T42A . The graph shows that peptides with a large fold-change in binding affinity (larger bubble) have a large fold-change in EC 50 values for SHP2 T42A over SHP2 WT (distance from dotted line). All EC 50 values can be found in Table S5.

Article Snippet: The SHP2 full-length, wild-type gene used as the template for all SHP2 constructs in this study was cloned from the pGEX-4TI SHP2 WT plasmid, which was a generous gift from Ben Neel (Addgene plasmid #8322).

Techniques: Activation Assay, Incubation, Phospho-proteomics, De-Phosphorylation Assay, Binding Assay, Comparison

Journal: bioRxiv

Article Title: The pathogenic T42A mutation in SHP2 rewires interaction specificity and enhances signaling

doi: 10.1101/2023.07.10.548257

Figure Lengend Snippet: ( A ) Schematic diagram depicting the co-immunoprecipitation (co-IP) experiments with SHP2 and either Gab1, Gab2, or PD-1 in HEK293 cells. The interactor proteins are phosphorylated by a hyperactive form of c-Src kinase. SHP2 co-immunoprecipitation experiments with ( B ) Gab1, ( C ) Gab2, and ( D ) PD-1, demonstrating that SHP2 T42A binds tighter to these phosphoproteins than SHP2 WT . In each case, SHP2 was immunoprecipitated via its myc-tag. Co-immunoprecipitation of the interacting protein was detected using an α-FLAG antibody for Gab1/Gab2 and a PD-1-specific antibody for PD-1. For PD-1, the experiment was also conducted by immunoprecipitating PD-1 and detecting co-immunoprecipitation of SHP2 using an α-myc antibody. ( E ) Schematic depiction of EGF stimulation and phospho-Erk signaling experiments in the presence of co-expressed SHP2 and either Gab1 or Gab2. ( F ) Comparison of phospho-Erk levels in response to EGF stimulation in cells expressing Gab1 and either SHP2 WT or SHP2 T42A . ( G ) Comparison of phospho-Erk levels in response to EGF stimulation in cells expressing Gab2 and either SHP2 WT or SHP2 T42A . For panels (F) and (G), the numbers below the blots indicate phospho-Erk levels relative to the 0 minute sample with SHP2 WT .

Article Snippet: The SHP2 full-length, wild-type gene used as the template for all SHP2 constructs in this study was cloned from the pGEX-4TI SHP2 WT plasmid, which was a generous gift from Ben Neel (Addgene plasmid #8322).

Techniques: Immunoprecipitation, Co-Immunoprecipitation Assay, Comparison, Expressing

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: BRCT-domain protein BRIT1 influences class switch recombination

doi: 10.1073/pnas.1708211114

Figure Lengend Snippet: BRIT1 and MDC1 could both contribute to the ATM–γ-H2AX axis of DSB resolution during CSR. (A) Representative flow cytometry of CSR to IgG1 in splenic B cells derived from Mb1-Cre control, BRIT1 KO, and AID KO mice treated with ATMi or with DMSO vehicle control. (B) Quantification of CSR to IgG1 (n = 3; **P < 0.005, *P < 0.05). (C) Immunoblot analysis of whole-cell lysates from control, BRIT1 KO, or AID KO cells treated with ATMi or DMSO. (D) Immunoblot analysis of whole-cell lysates from control or BRIT1 KO cells transduced with two different MDC1 shRNAs (sh1 and sh2) or scrambled control. (E) Representative flow cytometry of CSR to IgG1 in splenic B cells of indicated genotypes expressing MDC1 knockdown shRNAs sh1 or sh2. (F) Quantification of CSR to IgG1 (n = 3; **P < 0.005, *P < 0.05).

Article Snippet: Target sequences are listed in . table ft1 table-wrap mode="anchored" t5 Table S3. caption a7 Target Sequence Mouse MDC1 sh1 5′- ACAGCATGCAGTAATTGAA -3′ Mouse MDC1 sh2 5′- ACACAGCCGTTCTGTCTAA -3′ Mouse MDC1 sh3 5′- GCCGCTTGAGTTGCCAGACGACACCTGCT -3′ Mouse MDC1 sh4 5′- GTAGGTCTGCTGTCAAGACTCCTGAAGCG -3′ Scramble for sh1 and sh2 5′- GCGAAAGATGATAAGCTAA -3′ (Addgene plasmid no. 30520) Scramble for sh3 and sh4 5′- GCACTACCAGAGC TAACTCAGATAGTACT -3′ Open in a separate window shRNA sequences against mouse MDC1 and scramble control

Techniques: Flow Cytometry, Derivative Assay, Control, Western Blot, Transduction, Expressing, Knockdown

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: BRCT-domain protein BRIT1 influences class switch recombination

doi: 10.1073/pnas.1708211114

Figure Lengend Snippet: shRNA sequences against mouse MDC1 and scramble control

Article Snippet: Target sequences are listed in . table ft1 table-wrap mode="anchored" t5 Table S3. caption a7 Target Sequence Mouse MDC1 sh1 5′- ACAGCATGCAGTAATTGAA -3′ Mouse MDC1 sh2 5′- ACACAGCCGTTCTGTCTAA -3′ Mouse MDC1 sh3 5′- GCCGCTTGAGTTGCCAGACGACACCTGCT -3′ Mouse MDC1 sh4 5′- GTAGGTCTGCTGTCAAGACTCCTGAAGCG -3′ Scramble for sh1 and sh2 5′- GCGAAAGATGATAAGCTAA -3′ (Addgene plasmid no. 30520) Scramble for sh3 and sh4 5′- GCACTACCAGAGC TAACTCAGATAGTACT -3′ Open in a separate window shRNA sequences against mouse MDC1 and scramble control

Techniques: shRNA, Plasmid Preparation